BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg951805 Length=397 Score E Sequences producing significant alignments: (Bits) Value AT4G19220.1 | Symbols: | Tetratricopeptide repeat (TPR)-like s... 111 4e-24 > AT4G19220.1 | Symbols: | Tetratricopeptide repeat (TPR)-like superfamily protein | chr4:10505266-10508121 REVERSE LENGTH=2799 Length=2799 Score = 111 bits (60), Expect = 4e-24 Identities = 64/66 (97%), Gaps = 0/66 (0%) Strand=Plus/Plus Query 96 TCTTGTGATTCGTCTGACTCTCTCATCTTTGGCAAATCAGTCCACTGTTGGCTGCAAATG 155 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | Sbjct 1516 TCTTGTGATTCCTCTGACTCTCTCATCTTTGGCAAATCAGTCCACTGTTGGCTGCAAAAG 1575 Query 156 CTAGGG 161 |||||| Sbjct 1576 CTAGGG 1581 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 18749870377 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5