BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg952388 Length=293 Score E Sequences producing significant alignments: (Bits) Value AT5G15410.1 | Symbols: DND1, ATCNGC2, CNGC2 | Cyclic nucleotide... 152 2e-36 > AT5G15410.1 | Symbols: DND1, ATCNGC2, CNGC2 | Cyclic nucleotide-regulated ion channel family protein | chr5:5003307-5006882 REVERSE LENGTH=2453 Length=2453 Score = 152 bits (82), Expect = 2e-36 Identities = 105/116 (91%), Gaps = 1/116 (1%) Strand=Plus/Plus Query 44 TGGTCACATGTAGCTTCAATTTAGATTGGCTTACGTCTCCCGAGATTCGCTTGTCGTTGG 103 ||| ||| ||| ||||||||| ||| |||| |||||||| |||| |||||||||||||| Sbjct 657 TGG-CACGTGTGGCTTCAATTCAGACTGGCCTACGTCTCGAGAGAGTCGCTTGTCGTTGG 715 Query 104 TTGTGGCAAGCTCGTTTGGGATCCACACGCCATCGCGTCTCACTACGCACGCTCTC 159 |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct 716 TTGTGGGAAGCTCGTTTGGGATCCACGCGCCATCGCGTCTCACTACGCACGCTCTC 771 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 13522024481 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5