BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: halleri_transcript_ahg.fa 32,672 sequences; 38,939,717 total letters Query= AT1G25280.1 Length=2112 Score E Sequences producing significant alignments: (Bits) Value Ahg896941 jgi|Araly1|896941|Al_scaffold_0005_907 67.6 4e-10 > Ahg896941 jgi|Araly1|896941|Al_scaffold_0005_907 Length=516 Score = 67.6 bits (36), Expect = 4e-10 Identities = 36/36 (100%), Gaps = 0/36 (0%) Strand=Plus/Plus Query 487 GTGAGTGGAGTCTCTCATCTTAGTCTGAAGCTCttt 522 |||||||||||||||||||||||||||||||||||| Sbjct 16 GTGAGTGGAGTCTCTCATCTTAGTCTGAAGCTCTTT 51 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 79456251070 Database: halleri_transcript_ahg.fa Posted date: Sep 25, 2014 2:02 AM Number of letters in database: 38,939,717 Number of sequences in database: 32,672 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5