BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: halleri_transcript_ahg.fa 32,672 sequences; 38,939,717 total letters Query= AT2G46390.1 Length=348 Score E Sequences producing significant alignments: (Bits) Value Ahg483793 jgi|Araly1|483793|fgenesh2_kg.4__2853__AT2G46380.1 71.3 4e-12 > Ahg483793 jgi|Araly1|483793|fgenesh2_kg.4__2853__AT2G46380.1 Length=2570 Score = 71.3 bits (38), Expect = 4e-12 Identities = 38/38 (100%), Gaps = 0/38 (0%) Strand=Plus/Minus Query 311 AGATTCTTGTTACTAATAATGATATTTCATTTTCCACT 348 |||||||||||||||||||||||||||||||||||||| Sbjct 2570 AGATTCTTGTTACTAATAATGATATTTCATTTTCCACT 2533 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 12362410836 Database: halleri_transcript_ahg.fa Posted date: Sep 25, 2014 2:02 AM Number of letters in database: 38,939,717 Number of sequences in database: 32,672 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5