BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: halleri_transcript_ahg.fa 32,672 sequences; 38,939,717 total letters Query= AT3G28945.1 Length=5675 Score E Sequences producing significant alignments: (Bits) Value Ahg896827 jgi|Araly1|896827|Al_scaffold_0005_793 108 6e-22 > Ahg896827 jgi|Araly1|896827|Al_scaffold_0005_793 Length=666 Score = 108 bits (58), Expect = 6e-22 Identities = 62/64 (97%), Gaps = 0/64 (0%) Strand=Plus/Plus Query 1447 GGAGGAGGCAAAAGAAAAGCTACTGATGAGGCTGAAGTTCCATCCAAAGTTGCAAAGTGC 1506 |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct 196 GGAGGAAGCAAAAGAAAAGCTACTGATGAGGGTGAAGTTCCATCCAAAGTTGCAAAGTGC 255 Query 1507 AACA 1510 |||| Sbjct 256 AACA 259 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 214949172304 Database: halleri_transcript_ahg.fa Posted date: Sep 25, 2014 2:02 AM Number of letters in database: 38,939,717 Number of sequences in database: 32,672 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5