BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: halleri_transcript_ahg.fa 32,672 sequences; 38,939,717 total letters Query= ATMG00630.1 Length=333 Score E Sequences producing significant alignments: (Bits) Value Ahg932769 jgi|Araly1|932769|scaffold_400757.1 95.3 2e-19 > Ahg932769 jgi|Araly1|932769|scaffold_400757.1 Length=433 Score = 95.3 bits (51), Expect = 2e-19 Identities = 53/54 (98%), Gaps = 0/54 (0%) Strand=Plus/Plus Query 24 GTTGCCCATCTCCCATTTAATCGGAACGGAAGTAAGAAATCTAATATCTGTACG 77 ||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct 311 GTTGCCCATCTCCCATTTAATCGGAACGGAAGTCAGAAATCTAATATCTGTACG 364 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 11790077001 Database: halleri_transcript_ahg.fa Posted date: Sep 25, 2014 2:02 AM Number of letters in database: 38,939,717 Number of sequences in database: 32,672 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5